FAQ Database Discussion Community


Scala: map a Map to list of tuples

list,scala,dictionary,tuples,seq
I tried to use Map.map to convert a map into a List of Tuples. However this fails. I did the following experiments: val m = Map(("a" -> 1), ("b" -> 2)) //> m : scala.collection.immutable.Map[String,Int] = Map(a -> 1, b -> 2) val r1 = m.map{ case (k,v) => v}...

How to loop through a range of decimal numbers in bash?

linux,bash,for-loop,seq
I'd like to generate a sequence of equally spaced decimal numbers. For example, I want to echo all numbers between 3.0 and 4.5, with step 0.1. I tried $ for i {3.0..4.5..0.1}; do echo $i; done, but this gives an error. I also tried $ for i in $(seq 3.0...

Subset sequence data in fasta file based on IDs stored in listed data frames

r,subsetting,fasta,seq
I am trying to subset one FASTA file (containing multiple sequences) into several smaller ones based on IDs I stored in a list of data frames (and I have a FASTA called fastafile like this: fastafile <- dput(fastafile) structure(list(r1 = "acatattggaggccgaaacaatgaggcgtgatcaactcagtatatcac", r2 = "ctaacctctcccagtgtggaacctctatctcatgagaaagctgggatgag", r3 = "atttcctcctgctgcccgggaggtaacaccctggacccctggagtctgca", r4 = "acatattggaggccgaaacaatgaggcgtgatcaactcagtatatcgg",...

how do you make a sequence using along.with for unique values in r

r,seq
Lets suppose I have a vector of numeric values [1] 2844 4936 4936 4972 5078 6684 6689 7264 7264 7880 8133 9018 9968 9968 10247 [16] 11267 11508 11541 11607 11717 12349 12349 12364 12651 13025 13086 13257 13427 13427 13442 [31] 13442 13442 13442 14142 14341 14429 14429 14429...

How to go about a d-smooth sequence algorithm

algorithm,sorting,sequence,seq
I'm really struggling to design an algorithm to find d, which is the lowest value that can be added or subtracted (at most) to make a given sequence strictly increasing. For example.. say seq[] = [2,4,8,3,1,12] given that sequence, the algorithm should return "5" as d because you can add...

Avoid the 'seq' command in Bash?

bash,seq
I'm having a discussion about the use of seq for small loop in a Bash script (for example a loop with 10 iterations). I say, for example, is better do this for i in {1..10} do echo "Welcome $i times" done than use seq for i in $(seq 10) do...

Assigning a value for each dataset and plot it with ggplot

r,ggplot2,lapply,assign,seq
It can be complicated problem but I will try to explain it as much as I could. I have a sequenced dataset containing number of observations which should be processed before plotting. I want do it with a function. because I have another datasets in the directory (around 20) #reproducible...

Scala: remove first column (first element in each row)

arrays,scala,seq
Given an var x: Array[Seq[Any]], what would be the most efficient (fast, in-place if possible?) way to remove the first element from each row? I've tried the following but it didn't work - probably because of immutability... for (row <- x.indices) x(row).drop(1) ...

Scala - finding first position in which two Seq differ

scala,diff,sequence,seq
Scala comes with the nice corresponds method: val a = scala.io.Source.fromFile("fileA").getLines().toSeq() val b = scala.io.Source.fromFile("fileB").getLines().toSeq() val areEqual = a.corresponds(b){_.equals(_)} if(areEqual) ... And I quite like the brevity of that. Is there a similar method already defined that will also report to me the first position in which the two sequences...

Reshape start-end time intervals to smaller intervals in R

r,apply,reshape,seq
Here is duration data by time intervals. id <- c("A", "B", "B", "B", "C", "C", "D", "E", "F", "F", "F", "F") start <- c(368, 200, 230, 788, 230, 521, 272, 306, 0, 162, 337, 479) end <- c(373.98, 229.98, 233.98, 842.98, 239.98, 639.98, 285.98, 306.98, 95.98, 162.98, 339.98, 539.98) value...

In R, why doesn't -1 + 1 = 0 [duplicate]

r,seq,cumsum
This question already has an answer here: Why are these numbers not equal? 3 answers Can someone please help me understand why -1 + 1 <> 0 ? Can someone please help me understand why I get three different values between the built-in function consum(), my function ct(), and...

How to generate random numbers in a data.frame with range

r,random,data.frame,seq
I have a data.frame which I want to generate random numbers each list by a sequence. I used sample function to create random numbers but even I created random numbers for list [[1]], for set [[2]] same numbers produced again. So, here how can I create different random numbers for...

add numbers to beginning of each line increasing by 1 every nth line

awk,sed,seq
Starting with number 1, how to add this number in front of the direct following next x lines, followed by number 2 also for the following next x lines, and so on, end must be by y lines, how to do that? 1 jeriro ieieie ieiue 1 ieirirp wzwezeg 1...

Seq.map and Seq.mapi optimize away side effects when anonymous function returns unit?

dictionary,f#,seq,side-effects
While debugging a memoization function I found myself trying to find out whether Seq.mapi was actually iterating over a sequence, so I replaced an anonymous function with a printfn call like so: let x = "test" |> Seq.map (fun c -> c |> printfn "%c") Quite to my surprise, the...

R creating a sequence table from two columns

r,data.frame,seq
I have a table as below product=c("a","b","c") min=c(1,5,3) max=c(1,7,7) dd=data.frame(product,min,max) > dd product min max 1 a 1 1 2 b 5 7 3 c 3 7 I want to create a table which will look like below. I want to create one row for each value between and including...

Missing last sequence in seq() in R

r,seq
I have this example data by<-200 to<-seq(from=by,to=35280,by=by) Problem is that to ends at 35200 and ignore the last 80 which I need to involve in as last value. Is there any straigthforward way how to achieve it? I have tried along.with and length.out parameters but I cannot go trough....

Add an index (or counter) to a dataframe by group in R

r,indexing,counter,plyr,seq
I have a df like ProjectID Dist 1 x 1 y 2 z 2 x 2 h 3 k .... .... I want to add a third column such that we have an incrementing counter for each ProjectID: ProjectID Dist counter 1 x 1 1 y 2 2 z 1...

How JOIN Seq with Array in Clojure?

arrays,mongodb,clojure,seq
I would try to perform a SQL JOIN like on results from MongoDB. I have data to show on grid: seqgroup: ({:_id #<ObjectId 54db3ba76a5b2d5de2e7e990>, :group_name gr1, :usersingroup_id [#<ObjectId 54d1e37a2039b30a00b342ca> #<ObjectId 54d8ab240e81f5d1cbf6f691>]} {:_id #<ObjectId 54db46ba6a5b2d5de2e7e992>, :group_name gr2, :usersingroup_id [#<ObjectId 54d8af860e81f5d1cbf71da3> #<ObjectId 54d8ab240e81f5d1cbf6f691>]}) Instead of ObjectId for :usersingroup_id I would like to...