bash,unix,terminal,bioinformatics,qiime , remove the first 15 characters from every other line in a file
remove the first 15 characters from every other line in a file
Question:
Tag: bash,unix,terminal,bioinformatics,qiime
I have some txt files that look like this (they contain DNA sequences and sample codes):
>SRR1502445.1
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCAACACAGGGGGATAGGNNNNNNNNNNNNNNNNNNNNNNN
>SRR1502445.2
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.3
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.4
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNNNNNNNNNN
I would like to remove the first 15 characters of every other line in the file. This would remove the string GACTACACGTAGTAT
from the second, fourth, sixth, eighth lines (etc).
For instance the cut command can remove the first 15characters of every line:
cut -c 1-15 /path/to/file.txt
I'd like to apply to to only every other line, starting with the second.
Answer:
If you don't mind using sed
and assuming other line starts with >
then the following will remove the first 15 contiguous uppercase characters "A-Z" of the other lines:
sed 's/^[A-Z]\{15\}//' file > new_file
Or, in place edit (GNU sed) use -i
:
sed -i 's/^[A-Z]\{15\}//' file
Or, in place edit (BSD sed) use -i ''
:
sed -i '' 's/^[A-Z]\{15\}//' file
Or, back it up:
sed -i.bak 's/^[A-Z]\{15\}//' file
Example:
$ cat file
>SRR1502445.1
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCAACACAGGGGGATAGGNNNNNNNNNNNNNNNNNNNNNNN
>SRR1502445.2
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.3
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.4
GACTACACGTAGTATACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNNNNNNNNNN
$ sed 's/^[A-Z]\{15\}//' file
>SRR1502445.1
ACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCAACACAGGGGGATAGGNNNNNNNNNNNNNNNNNNNNNNN
>SRR1502445.2
ACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.3
ACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNN
>SRR1502445.4
ACGAGTGCGTTCCTGCGCTTATTGATATGCTTAAGTTCAGCGGGTAGTCTCACCCGATTTGAGGTCAAGGTTTGTGGGTCGAGTCACAACTCGAACATCGTCTTTGTACAAAGACGGTTGGAAGCGGGTTCCAAGGCACACAGGGGATAGGNNNNNNNNNNN
$
Related:
bash,shell
I am writing a bash script and I would like to verify if a string is a shell reserved word (like if, for, alias, etc...). How can I can do this?...
bash,error-handling,find,io-redirection
I was recently searching for a way to filter out 'Permission denied' errors while searching for a file using the find command, and I found this link: How can I exclude all "permission denied" messages from "find"? Here's an the answer that worked for me from the link: find ....
python,bash,environment-variables
I can't access my env var: import subprocess, os print os.environ.get('PATH') # Works well print os.environ.get('BONSAI') # doesn't work But the env var is well added in my /home/me/.bashrc: BONSAI=/home/me/Utils/bonsai_v3.2 export BONSAI And I can access this env var from a new terminal....
perl,unix
How to capture piped command's argument ? I use : perl my_script.pl -some_args | tee arg_filename How to get arg_filename 's value inside my_script.pl ? CONTEXT I need to send this filename in a mail which my_script.pl sends at the end. I need to use tee because we dump huge...
bash,shell,unix
So in my bash shell script, I have it running through a for loop. Inside the for loop, I use find "$myarray[i]" >> $tmp to look for a certain directory each time through the loop. Sometimes, it finds the variable in myarray[i] and sometimes it doesn't. When it does find...
linux,shell,unix,replace,grep
I have a very huge file which looks like this: <a>text</a>text blah <b>data1</b>abc<b>data2</b> <b>data3</b>blahblah <c>text</c> <d>text</d> <x>blahblah<b>data4 data5 data6</b> <b>data7 </x> That is, its formatting is unpredictable. I need to extract each <b>...</b> item (it might contain multiline text!) and put every one of them in a single separate line....
bash,command-line-arguments
I'm running the following interactive Jar. java -jar script.jar argument-line-here \n Now I'm creating a bash script which runs the jar file. How do I pass the argument line and the conformation "\n" to this interactive script? these are input lines for the script. This question has some answers, expect...
bash,if-statement,integer
COUNTER=0 let COUNTER=COUNTER+1 count=`ssh -i /var/www/.ssh/id_rsa_root -o stricthostkeychecking=no $host $cmd` count1=`echo $count | awk '{print $4}'` printf "count1 : $count1\n" result1=${count1/.*} if [ "$result1" -ge "0" ]; then echo $host else echo $host exit fi If the value of $result1 is INTEGER and greater than zero, it'll goto IF loop...
bash,awk,sed
How can I replace [a-z],[a-z] with [a-z], [a-z] and keeping the letters? Input suny stony brook, stony brook,usa. Output suny stony brook, stony brook, usa. What I have tried sed 's/[a-z],[a-z]/[a-z], [a-z]/g' <<< "suny stony brook, stony brook,usa." sed 's/[a-z],[a-z]/, /g' <<< "suny stony brook, stony brook,usa." ...
linux,bash,shell,unix,find
I'm running a find command multiple times on the same group of files. The results of my find commands are usually disjoint sets, AKA I'm running find -mmin +35; find -mmin -25, and doing different things to the results. It seems sort of silly to search through the entire file...
bash,svn,svn-externals
I have multi externals need to be set within a file externals.txt and I attempt to change the svn:externals from a bash: svn pe svn:externals svn://hostname/branchname -F extenals.txt But the command throws out an error: svn: E205007: None of the environment variables SVN_EDITOR, VISUAL or EDITOR are set, and no...
bash,shell,curl,command-line,pipe
When I run the curl command and direct the data to a file, I get back the content of the site as expected. $ curl "www.site.com" > file.txt $ head file.txt Top of site ... However, this command shows a progress bar, which I do not want: % Total %...
unix,encryption,freebsd,boot,zfs
I have a 3 Disk RAIDz1 Pool, encrypted with AES128 in GEOM_ELI, that I have been using in FreeNAS since version 8. There have been many zpool upgrades, and over all I am very happy with ZFS. Lately however I have been growing frustrated with FreeNAS. Largely many bugs that...
bash,scope,subshell
I was doing something very simple like: v=5 echo "$v" and expected it to print 5. However, it does not. The value that was just set is not available for the next command. I recently learnt that "In most shells, each command of a pipeline is executed in a separate...
regex,bash,shell,ssh,sed
I am trying to replace the bottom one of these 2 lines with sed in a file. <rule>out_prefix=orderid ^1\\d\+ updatemtnotif/</rule>\n\ <rule>out_prefix=orderid ^2\\d\+ updatemtnotif/</rule>\n\ And the following command seems to do that when executed as a command at the bash prompt sed -i '[email protected]_prefix=orderid ^2\\\\d\\+ updatemtnotif/@out_prefix=orderid ^2\\\\d\\+ updatemtnotif_fr/@g' /opt/temp/rules.txt however, when...
bash
This question already has an answer here: bash redirect input from file back into same file 7 answers When you try to sort a file in-place with sort afile > afile you silently end up with afile being an empty file. Why is that? I'd expect either an error...
bash,sed
I have a script that I am writing that checks a value and then based on the value modifies it. I am trying to understand why it works this one way and not the other. Based on the google and stackoverflow searches I did, nothing really fits what I am...
arrays,linux,bash
I want to modify an array cell, which I can do when I know the cell as a number. However here my cell position is given by $i. pomme[`${i}`]="" I tried without the `` and it doesn't work either? How am I suppose to do it?...
bash,shell,shellcode
The file is like this aaa&123 bbb&234 ccc&345 aaa&456 aaa$567 bbb&678 I want to output:(contain "aaa" and text after &) 123 456 I want to do in in shell script, Follow code be consider #!/bin/bash raw=$(grep 'aaa' 1.txt) var=$(cut -f2 -d"&" "$raw") echo $var It give me a error like...
linux,bash,shell
For example say I have: filename1.ext1 filename1.ext2 filename2.ext1 filename2.ext2 I need to write a shell script to feed these files into a program like so: program filename1.ext1 filename1.ext2 program filename2.ext1 filename2.ext2 Additionally the .ext1 files must be entered first and the .ext2 files second. Any help would be appreciated....
bash,printf,echo
How do you print each name of a file from a directory into a string and make make new scripts? to print each file name for i in `ls new_manifest*`; do echo $i; done but when I try and print the rest of the string with $i like this is...
regex,string,bash,shell,grep
I've got a few peculiar issues with trying to search for a string inside of a .db file. The way I tried was by using grep, which does apparently find the string(s), although this is the output: $ grep "ext" *.db Binary file enormous.db matches There are a couple problems...
linux,bash,awk
I have a very big CSV file (aprox. 10.000 rows and 400 columns) and I need to modify certain columns (like 15, 156, 220) to change format from 20140321132233 to 2014-03-21 13:22:33. All fields that I need to modify are datetime. I saw some examples using awk but for math...
linux,bash,awk,sed,sh
I am trying to use a script to append the host name at the end of a multi-line entry of a specific Host_Alias field in sudoers file. The current sudoers file has an entry similar to : Host_Alias srv_linuxestate= \ host10,host12,host13,host1,host50,\ host16,host1,host2,host11,host15,host21,\ host3,host14 My required output would be something like...
linux,bash,awk,scripting
I want to calculate the average of the 5th column (last column) excluding the rows with the value "9999". Would appreciate your feedback. 77.300 16 1 3.6112914285714268 9.4 77.300 16 2 -0.001737142857145102 20.0 77.300 16 3 5.1570742857142857 8.9 77.300 17 0 3.6112914285714268 8.9 77.300 17 1 2.9484342857142849 11.7 77.300 17...
linux,bash,shell,awk,sed
I have a CSV file with columns A,B,C,D. Column D contains values on a scale of 0 to 1. I want to use AWK to write to a new column E base in values in column D. For example: if value in column D <0.7, value in column E =...
bash,if-statement
I currently have this bash script (which is located in my home directory, i.e., /home/fusion809/ and I am running it as root as it's necessary for the icon copying lines): cd /home/fusion809/Pictures/Icon* declare -a A={Arch,Debian,Fedora,Mageia,Manjaro,OpenSUSE} declare -a B={Adwaita,Faenza,gnome,Humanity} for i in $A; do for j in $B; do if test...
linux,bash
In a bash script I have: Check="grep -e '"'\(-S mount\)'"' /etc/audit/audit.rules" set -x When you run it it shows it as: CHECK='grep -e '\''\(-S mount\)'\'' /etc/audit/audit.rules' Now it works exactly what I want but I want to understand it. Why is there 2 extra \'s?...
osx,shell,unix
I have 2 shell scripts and 2 mpkg installer, I am trying to use an unix excitable file to run them all. here is the script I have, but it always has error message "No such file or directory" ? #!/bin/sh # Find the absolute script current path path=$( cd...
bash
I have an alias gl which is an wrapper for git log. Basically like this function gitLog(){ if [ $# -eq 0 ] then git log else git log -n $1 } alias gl=gitLog I want to add an alias which just calls gitLog with an argument like this alias...
git,bash,shell,unix,binary
I am on a Macbook Pro on Mac OS X 10.10 (Yosemite). When I go to /usr/bin, git is there as a unix executable file. When I open it up in Sublime Text, all I get is unreadable machine code. However, when I open up a different Unix executable fileāin...
bash,shell,tail
I want a run a long task on a remote machine (with python fabric using ssh). It logs to a file on the remote machine. What I want to do is to run that script and tail (actively display) the log file content until the script execution ends. The problem...
php,bash,drupal,terminal,macports
I'm trying to switch my Terminal PHP version to 5.4 because I ran into some issues with Drush while updating my Drupal core. http://drupal.stackexchange.com/questions/112090/drush-command-errors The reason for these issues is my Terminal PHP version is different then my localhost. php -v in Terminal returns PHP 5.5.13 (cli) but my localhost...
unix,awk
I've been trying to extract lines where a number in one columns falls within a particular range. Lets say I have a file that looks as so: chrom prediction chrom1 0.75 chrom2 0.5 chrom4 0.76 If I wanted to print lines where the prediction value was in the range from...
bash,unix,putty
This question already has an answer here: How to return the output of program in a variable? 4 answers I am using Putty with bash-4.2. Therein, I am outputting file size with: du -m myfile.csv which returns: 1.25 myfile.csv How do i store this line in a variable so...
bash,ssh
Here is my problem. I need to run a command ./deploy.sh -u 1540 This will fetch version 1540 of deploy.sh on SVN When I do, the script access SVN and ask for a password. I'm using ssh. It will first ask me a password since it guesses my SVN login...
linux,string,bash,shell,variables
I would like to extract the first letter of dashed separated words value of my bash variable, like this: MY_TEXT=this-is-my-custom-text I would like to create a second variable like this: MY_INITIALS=timct...
bash,awk
Is it possible? I was wondering how to do: Count fields differentiated by comma. Only the obtained first field of the previous step, count words differentiated by space. If there is more than 2 words, print NF, otherwise $0. Input cellular biol immunogenet, rosario escuela estadist, medellin medellin Expected output...
java,unix,jsch
I am trying a Java program to run multiple commands in unix environment. I would need to pass 'ENTER' after each command. Is there some way to pass enter in the InputStream. JSch jsch=new JSch(); Session session=jsch.getSession("MYUSERNAME", "SERVER", 22); session.setPassword("MYPASSWORD"); Properties config = new Properties(); config.put("StrictHostKeyChecking", "no"); session.setConfig(config); session.connect(); Channel...
linux,bash,rhel
I am new to bash and writing a script to read variables that is stored on each line of a text file (there are thousands of these variables). So I tried to write a script that would read the lines and automatically output the solution to the screen and save...
bash,replace,count
Ten files located in a directory. Each file content has "apple" word. write a bash shell script to replace "apple" with "banana" in all ten files and Print the number of replacements for each file. Have tried in this way but dont know how to get number of replacement. can...
linux,bash,csv,awk
i have CSV file with some database benchmark results here is the example: Date;dbms;type;description;W;D;S;results;time;id Mon Jun 15 14:22:20 CEST 2015;sqlite;on-disk;text;2;1;1;570;265;50 Mon Jun 15 14:22:20 CEST 2015;sqlite;on-disk;text;2;1;1;420;215;50 Mon Jun 15 14:22:20 CEST 2015;sqlite;on-disk;text;2;1;1;500;365;50 Mon Jun 15 14:22:20 CEST 2015;sqlite;on-disk;text;2;1;1;530;255;50 Mon Jun 15 14:22:20 CEST 2015;hsql;on-disk;text;2;1;1;870;265;99 Mon Jun 15 14:22:20 CEST 2015;hsql;on-disk;text;2;1;1;620;215;99...
bash
I've got a script which has multiple stages, and at each stage it's possible to fail, but the script can carry on running. Concretely, I generate some json, and check if the diff is correct. The diff could be wrong, but it doesn't stop the next stage of json being...
osx,bash,rename
I have a directory called "Theme_1" and I want to capitalize all the filenames starting with "theme". The first letter of every file name is lowercase and I want it to be upcase. I've tried this but all the letters in the filename are upcase, which is not what I...
bash
I need to write a bash script which copies all .c files from a directory $2 to another directory $1, but without comments. I only have to remove comments that begin with //, might have tabs/spaces before the comment, but not letters. Also, I need to do it with only...
osx,bash,shell
first time post so please let me know how I could improve.. I created a shell script which requires a person to input their name and then generates a report. The script works as needed when chmod'd into an executable script and run from terminal. But, I would like to...